View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16393_low_5 (Length: 322)
Name: NF16393_low_5
Description: NF16393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16393_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 302
Target Start/End: Original strand, 49928139 - 49928428
Alignment:
| Q |
13 |
aatatcacaattaaaatatgctacaaattttcattgactaccaatgtatgaatttctgatatccttgtcatgtggttgaccgtcaaagagtcaaaattca |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49928139 |
aatatcacaattaaaatctgctacaaattttcattgactaccaatgtatgaatttctgatatccttgtcatgtggttgaccgtcaaagagtcaaaattca |
49928238 |
T |
 |
| Q |
113 |
aaaacgtgtgttgacaacaccgtaaattacacgttcattggagtagtttgttttgttcaacttcaacatcgttcaaaacnnnnnnnngcacaacgtgctc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49928239 |
aaaacgtgtgttgacaacaccgtaaattacacgttcattggagtagtttgttttgttcaacttcaacatcgttcaaaacaaaaaaaagcacaacgtgctc |
49928338 |
T |
 |
| Q |
213 |
tgttgaaattccaccgagctcagtaaccatggagctatctatgacaacgacactccgatttggatcacaaaaccacttcccttttccctt |
302 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49928339 |
tgttcaaattccaccgagctcagtaaccatggagctatctatgacaacgacactccgatttggatcacaaaaccacttccctcttccctt |
49928428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University