View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16393_low_6 (Length: 248)
Name: NF16393_low_6
Description: NF16393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16393_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 23 - 235
Target Start/End: Complemental strand, 52246080 - 52245868
Alignment:
| Q |
23 |
ggatgaacacaaaaatgttcaattccacttttcaaattcaaaccccctcccaacatattaaatttcggttttataaccattttaccaaggttnnnnnnnn |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52246080 |
ggatgaacacaaaaatgttcaattccacttttcaaattcaaaccccctcccaacatattaaatttcggttttataaccattttaccaaggttaaaaaaca |
52245981 |
T |
 |
| Q |
123 |
nnnnnnnnntatttccaaattcaacttttttcatactattgcgtagtgaaattatgaaaaacctgaccagttcccaaagtgggagaatctttgggaccat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52245980 |
aaataaaaatatttccaaattcaacttttttcatactattgcgtagtgaaattatgaaaaacctgaccagttcccaaagtggtagaatctttgggaccat |
52245881 |
T |
 |
| Q |
223 |
agactgtaaattt |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52245880 |
agactgtaaattt |
52245868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University