View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16393_low_6 (Length: 248)

Name: NF16393_low_6
Description: NF16393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16393_low_6
NF16393_low_6
[»] chr1 (1 HSPs)
chr1 (23-235)||(52245868-52246080)


Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 23 - 235
Target Start/End: Complemental strand, 52246080 - 52245868
Alignment:
23 ggatgaacacaaaaatgttcaattccacttttcaaattcaaaccccctcccaacatattaaatttcggttttataaccattttaccaaggttnnnnnnnn 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            
52246080 ggatgaacacaaaaatgttcaattccacttttcaaattcaaaccccctcccaacatattaaatttcggttttataaccattttaccaaggttaaaaaaca 52245981  T
123 nnnnnnnnntatttccaaattcaacttttttcatactattgcgtagtgaaattatgaaaaacctgaccagttcccaaagtgggagaatctttgggaccat 222  Q
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
52245980 aaataaaaatatttccaaattcaacttttttcatactattgcgtagtgaaattatgaaaaacctgaccagttcccaaagtggtagaatctttgggaccat 52245881  T
223 agactgtaaattt 235  Q
    |||||||||||||    
52245880 agactgtaaattt 52245868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University