View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16394_low_1 (Length: 296)
Name: NF16394_low_1
Description: NF16394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16394_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 34646373 - 34646569
Alignment:
| Q |
1 |
agagagctaccatagatcaaatatccatatcaactctatgaagaatgtttacttggaaagcaattcaggacgaagttttccaaag-agtcaagttcaaaa |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
34646373 |
agagagctaccataaatcaaatatccatatcaactttatgaagaatgtttacttggaaagcaattcaggacg-agtttttcaaagtagtcaagttcaaaa |
34646471 |
T |
|
| Q |
100 |
gcaaagaagtcgctcaagcttatacatgttaatgtttatgttaatgtttgtgggtcaatcaagccaaact--ctacgtaaaaatcacaattttctctttt |
197 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34646472 |
gcaaagaagtcgctcgagcttatac------------atgttaatgtttgtgggtcaatcaagccaaactcactacgtaaaaatcacaattttctctttt |
34646559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 269
Target Start/End: Original strand, 34646591 - 34646633
Alignment:
| Q |
227 |
tgcatgggtctatttcttgatgctgaaataaaaagtctttact |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34646591 |
tgcatgggtctatttcttgatgctgaaataaaaagtctttact |
34646633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University