View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16395_high_22 (Length: 351)
Name: NF16395_high_22
Description: NF16395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16395_high_22 |
 |  |
|
| [»] scaffold0172 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0172 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 86 - 350
Target Start/End: Complemental strand, 17472 - 17208
Alignment:
| Q |
86 |
aagggaaatgaaagcagatatgactatgagcaatgggattcacttacatcaaaattctctggagcagccaatctccctttcctgttacttcaaatgcctc |
185 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17472 |
aagggaaatgaaagaagatatgactatgagcaatgggattcacttacatcaaaattctctggagcagccaatctccctttcctgttacttcaaatgcctc |
17373 |
T |
 |
| Q |
186 |
aaattttacttaatgccagaaatctcattgctggaaataacactgctctttttgctattccatggctggtaatttcnnnnnnnnnnnngctattatgagt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17372 |
aaattttacttaatgccagaaatctcattgctggaaataacactgctctttttgctattccatggctggtaatttcttttttatttttgctattatgagt |
17273 |
T |
 |
| Q |
286 |
tgtgaacctgttttgtgattgactcgatttgttcatccattttaaaaatgtgatgtggtctgatg |
350 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17272 |
tgtgaacctgttttgtgattgagttgatttgttcatccattttaaaaacgtgatgtggtctgatg |
17208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0172; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 17573 - 17537
Alignment:
| Q |
1 |
ttctgatccacctcaccaggtacgtacctacactcac |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17573 |
ttctgatccacctcaccaggtacgtacctacactcac |
17537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0172; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 17528 - 17492
Alignment:
| Q |
30 |
acactcacattcacaataattgaagaatttaatcaca |
66 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17528 |
acactcacactcacaataattgaagaatttaatcaca |
17492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University