View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16395_high_35 (Length: 266)
Name: NF16395_high_35
Description: NF16395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16395_high_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 117 - 251
Target Start/End: Complemental strand, 5189029 - 5188894
Alignment:
| Q |
117 |
attttcaccctttggctcacttctattttcgcacatgctaactacgcagttttgcagtctttattctatatcatactt-atggtgctatgccatttgttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5189029 |
attttcaccctttggctcacttctattgaagcatctgctaactacgcagttttgcagtctttgctctatatcatacttgatggtgctatgccatttgttt |
5188930 |
T |
|
| Q |
216 |
ttgtgagtctttttgaccacaaattcactaattact |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5188929 |
ttgtgagtctttttgaccacaaattcgctaattact |
5188894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 5194731 - 5194606
Alignment:
| Q |
1 |
gtactttttatattaattttttaaatataacgggaacatcatattttggcactttgtttgccatataatatagatttg----nnnnnnnngggatatgaa |
96 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
5194731 |
gtactttttatattaattttctaaatataacgggaacatcatattttggcac-atgtttgccatataatatagatttgttttttttttttgggatatgaa |
5194633 |
T |
|
| Q |
97 |
atatgcttgctagttgctacattttca |
123 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5194632 |
atatgcttgctagttgctacattttca |
5194606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University