View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16395_high_39 (Length: 244)

Name: NF16395_high_39
Description: NF16395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16395_high_39
NF16395_high_39
[»] chr6 (5 HSPs)
chr6 (1-202)||(24708561-24708762)
chr6 (1-203)||(30511132-30511333)
chr6 (14-120)||(30483551-30483657)
chr6 (1-79)||(30501554-30501632)
chr6 (35-112)||(30475659-30475736)


Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 24708561 - 24708762
Alignment:
1 caatatattgggatacgcttatagcaatgaagaagaagttgtcaaatatgtagcaactatgttgccaattattgcagtatccaactttctggatggacta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||     
24708561 caatatattgggatacgcttatagcaatgaagaagaagttgtcaaatatgtagcaactatgttgcctattattgcagtatccaactttctggatggactt 24708660  T
101 caatgtgttctttcaggtttctcttattcccaataacttttaattctatgtcttcatagtggccgagtaaaaaacaatgatagatacatatgggagcttc 200  Q
    |||||||||||||||||||||||||||||| |||||| |||||||   |||||||||||||||||| ||||||||||||||||| ||||||||||| |||    
24708661 caatgtgttctttcaggtttctcttattccaaataacgtttaatttattgtcttcatagtggccgattaaaaaacaatgatagagacatatgggagtttc 24708760  T
201 ta 202  Q
    ||    
24708761 ta 24708762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 30511333 - 30511132
Alignment:
1 caatatattgggatacgcttatagcaatgaagaagaagttgtcaaatatgtagcaactatgttgccaattattgcagtatccaactttctggatggacta 100  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||    
30511333 caatatatggggatatgcttatagcaatgaagaagaagttgtcaaatatgtagcaattatgttgcctattattgcagtatccaactttctggatggaata 30511234  T
101 caatgtgttctttcaggtttctcttattcccaataacttttaattctatgtcttcatagtggccgagtaaaaaacaatgatagatacatatgggagcttc 200  Q
    ||| ||||||||||||||||||||| ||||| ||||||||||||| | | ||||||||| | | |||| |||||||| |||||| ||| |||||||||||    
30511233 caaagtgttctttcaggtttctcttcttccctataacttttaatt-tctttcttcatagagactgagtcaaaaacaacgatagagacaaatgggagcttc 30511135  T
201 taa 203  Q
    |||    
30511134 taa 30511132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 120
Target Start/End: Complemental strand, 30483657 - 30483551
Alignment:
14 tacgcttatagcaatgaagaagaagttgtcaaatatgtagcaactatgttgccaattattgcagtatccaactttctggatggactacaatgtgttcttt 113  Q
    |||||||||||||||||||||||||| || || ||||||||||||||| |||||||| |||| |||||| |||| || |||||  | |||  ||||||||    
30483657 tacgcttatagcaatgaagaagaagtggtaaattatgtagcaactatgatgccaattcttgccgtatcccacttactagatggcatgcaagctgttcttt 30483558  T
114 caggttt 120  Q
    |||||||    
30483557 caggttt 30483551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 30501632 - 30501554
Alignment:
1 caatatattgggatacgcttatagcaatgaagaagaagttgtcaaatatgtagcaactatgttgccaattattgcagta 79  Q
    |||||||| |||||| ||||||||||||||||||||||| |||||||||||||||| |||| ||||| || ||||||||    
30501632 caatatatggggatatgcttatagcaatgaagaagaagtggtcaaatatgtagcaaatatgatgccacttcttgcagta 30501554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 112
Target Start/End: Complemental strand, 30475736 - 30475659
Alignment:
35 gaagttgtcaaatatgtagcaactatgttgccaattattgcagtatccaactttctggatggactacaatgtgttctt 112  Q
    |||||||||||| |  |||||| |||||| |||||| ||||||||||| |||||||||||  ||||||| ||||||||    
30475736 gaagttgtcaaacaaatagcaattatgttaccaattcttgcagtatcctactttctggattcactacaaagtgttctt 30475659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University