View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16395_low_25 (Length: 330)
Name: NF16395_low_25
Description: NF16395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16395_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 6e-62; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 192 - 312
Target Start/End: Complemental strand, 24746539 - 24746419
Alignment:
| Q |
192 |
ctttgattttagaattttatatgttacaatcttgtagtacttgacaatgcttactcatatattatagttaacatatagatttctatttttcttggttttg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24746539 |
ctttgattttagaattttatatgttacaatcttgtagtacttgacaatgcttactcatatattatagttaacatatagatttctatttttcttggttttg |
24746440 |
T |
 |
| Q |
292 |
tatatttcagatgacagattt |
312 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24746439 |
tatatttcagatgacagattt |
24746419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 65 - 179
Target Start/End: Complemental strand, 24746964 - 24746848
Alignment:
| Q |
65 |
atagctattgcatcattctctatttcatgtgaaaattgt--gtcacactccatgattttatcaggatgaaacatggttgaagaaatacatgtagttaaag |
162 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24746964 |
atagctattgcatcattctttatttcatgagaaaattttatgtcacactccatgattttatcacgatgaaacatggttgaagaaatacatgtagttaaag |
24746865 |
T |
 |
| Q |
163 |
gagaaagcaaatgagag |
179 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24746864 |
gagaaagcaaatgagag |
24746848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 9379947 - 9379985
Alignment:
| Q |
20 |
accaatgtcaccgaccacaatatcacccaaatattatcc |
58 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
9379947 |
accaatgtcaccaaccacaatgtcacccaaatattatcc |
9379985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 44381946 - 44381906
Alignment:
| Q |
20 |
accaatgtcaccgaccacaatatcacccaaatattatccct |
60 |
Q |
| |
|
|||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
44381946 |
accaatatcaccaaccacaatgtcacccaaatattatccct |
44381906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 22893929 - 22893887
Alignment:
| Q |
20 |
accaatgtcaccgaccacaatatcacccaaatattatccctat |
62 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
22893929 |
accaatgtcaccaaccacaatgtcacccaagtattatccctat |
22893887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 2543773 - 2543733
Alignment:
| Q |
20 |
accaatgtcaccgaccacaatatcacccaaatattatccct |
60 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |||||||||| |
|
|
| T |
2543773 |
accaatgtcaccaaccacaatgtcacccaagtattatccct |
2543733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 59
Target Start/End: Original strand, 7755459 - 7755495
Alignment:
| Q |
23 |
aatgtcaccgaccacaatatcacccaaatattatccc |
59 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
7755459 |
aatgtcaccaaccacaatgtcacccaaatattatccc |
7755495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University