View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16395_low_26 (Length: 324)
Name: NF16395_low_26
Description: NF16395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16395_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 23 - 272
Target Start/End: Complemental strand, 520072 - 519833
Alignment:
| Q |
23 |
tattaattaatgaaactcttttgtttatagttattgtcaaagttacgtgcaatgcattggtgctgtctgtgacacacacatggtaccatccatgcacatg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
520072 |
tattaattaatgaaactcttttgtttatagttattgtcaaagttacgtgcaatgcattggtgctgtctgtgacacacacatggtaccat----gcacatg |
519977 |
T |
 |
| Q |
123 |
gagagtttttcattctccaaggttcttgttacaaacaactttttgatggtaagttgcaagggaccaaggggtcccggtccctctaagaaaaaccggtatg |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
519976 |
gagagtttttcattctccaaggttgttgttacaaacaacttttagatggtaagttgcaagggaccaaggggtcccggtccctctaagaaaaaccggtatg |
519877 |
T |
 |
| Q |
223 |
gcattaattataattaatttttataaatatagcaaactgctaaaaagaca |
272 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
519876 |
gcatta------attaatttatataaatatagcaaactgctaaaaagaca |
519833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University