View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16395_low_29 (Length: 301)
Name: NF16395_low_29
Description: NF16395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16395_low_29 |
 | |
|
| [»] scaffold0011 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 48 - 277
Target Start/End: Complemental strand, 240461 - 240235
Alignment:
| Q |
48 |
aatttgtatacaccgcactcaatgataccacttttttaggttaatttctaaaacatctctataactaattacttggcatgttttgattagatgcaatata |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240461 |
aatttgtatacaccgcactcaatgataccacttttttgggttaatttctaaaatatctctataactaattacttggcatgttttgattagatgcaatata |
240362 |
T |
|
| Q |
148 |
agcaagtaaaaatagtcacataaaatatgccacacacatacnnnnnnncacccatatcaagtcaaatacacaagcatcctctaatatccaaggaccgtcc |
247 |
Q |
| |
|
|| |||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240361 |
agtaagt-aaaatagtcacat--aatatgccacacacatacaaaaaaacacccatatcaagtcaaatacacaagcatcctctaatatccaaggaccgtcc |
240265 |
T |
|
| Q |
248 |
ttcttcatttgatgcaacatgattacatga |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
240264 |
ttctccatttgatgcaacatgattacatga |
240235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 240552 - 240505
Alignment:
| Q |
1 |
tttatacaccggaaaaccgatatgacttgtgaaaccataaatgtgaaa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240552 |
tttatacaccggaaaaccgatatgacttgtgaaaccataaatgtgaaa |
240505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 67 - 105
Target Start/End: Original strand, 44599484 - 44599522
Alignment:
| Q |
67 |
caatgataccacttttttaggttaatttctaaaacatct |
105 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
44599484 |
caatgataccacttctttaggttaatttctaaaatatct |
44599522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University