View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16395_low_54 (Length: 212)
Name: NF16395_low_54
Description: NF16395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16395_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 52807604 - 52807797
Alignment:
| Q |
1 |
tatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatctctttcagatttgaatgtccctaaccatattctttggtgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807604 |
tatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatctctttcagatttgaatgtccctaaccatattctttggtgatt |
52807703 |
T |
|
| Q |
101 |
tgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttcaacttttcacaccctgcaacatcctctacttcatacctccta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807704 |
tgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttcaacttttcacaccctgcaacatcctctacttcatacctccta |
52807797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University