View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16396_high_1 (Length: 250)

Name: NF16396_high_1
Description: NF16396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16396_high_1
NF16396_high_1
[»] chr3 (1 HSPs)
chr3 (11-93)||(47212804-47212886)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 11 - 93
Target Start/End: Original strand, 47212804 - 47212886
Alignment:
11 cgaagaatataccttccttcatgaactttgttgtatgatgtttcaagagttgttgttttcggattcgccaaacaagcaagctt 93  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47212804 cgaataatataccttccttcatgaactttgttgtatgatgtttcaagagttgttgttttcggattcgccaaacaagcaagctt 47212886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University