View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16397_low_10 (Length: 278)
Name: NF16397_low_10
Description: NF16397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16397_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 259
Target Start/End: Complemental strand, 46786510 - 46786266
Alignment:
| Q |
15 |
gagatgaaaatgaaacatattctgatgttatgattcgccgtgtaattcaagcataccaggtactacttagtaacttacttcttaaactcactctcattct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46786510 |
gagatgaaaatgaaacatattctgatgttatgattcgccgtgtaattcaagcataccaggtactacttagtaacttacttcttaaactcactcttattct |
46786411 |
T |
|
| Q |
115 |
ttttcctattcactaccacacatcatatacagcatagtaacgtgtaattagttcatttttaaccttcatgcnnnnnnnactgcagatactatccaactac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46786410 |
ttttcctattcactaccacacatcatatacagcatagtaacgtgtaatcagttcatttttaaccttcatgctttttttactgcagatactatccaactac |
46786311 |
T |
|
| Q |
215 |
acaccatcacaaattattgaaacgtaaactatctgttctttattc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46786310 |
acaccatcacaaattattgaaacgtaaaccatctgttctttattc |
46786266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University