View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16397_low_11 (Length: 262)
Name: NF16397_low_11
Description: NF16397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16397_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 22 - 252
Target Start/End: Complemental strand, 50055162 - 50054932
Alignment:
| Q |
22 |
gattgcatggtataatttatatcttaatttcttcatggcttatttactatttataatccctttagttaatgattggtatcacaatcaatttatcaacatc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50055162 |
gattgcatggtataatttatatcttaatttcttcatggcttatttactatttataatccctttagttaatgattggtatcacaatcaatatatcaacatc |
50055063 |
T |
 |
| Q |
122 |
ttgttcaccctgattttttacacactcatggtgataccaaatatacatttagttacttcaattttcttatatatgtatattaatatcacaagctttacaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
50055062 |
ttgttcaccctgattttttacacactcatggtgataccaaatatacatttagttacttcaattttcttatatatgtatattaatatcacaagctttacca |
50054963 |
T |
 |
| Q |
222 |
cacttgcacacgttgtcaccattcacctttg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50054962 |
cacttgcacacgttgtcaccattcacctttg |
50054932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University