View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16399_high_11 (Length: 376)
Name: NF16399_high_11
Description: NF16399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16399_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 25050725 - 25050955
Alignment:
| Q |
19 |
tatcggttgctgcgatttcgatattgatgcttccggcggatgtagcaaatcggcaagcttgccggcatgctatttataatggcgcgtgtaatctcacgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25050725 |
tatcggttgctgcgatttcgatattgatgcttccggcggatgtagcaaatcggcaagcttgccggcatgctatttataatggcgcgtgtaatctcacgct |
25050824 |
T |
 |
| Q |
119 |
cccgatgaagaatttgtggcttgcggtttatattatcgatgctattcttgtgttcttcgttattccttttgcaatgttctattatgaaggagaccaggac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25050825 |
cccgatgaagaatttgtggcttgcggtttatattatcgatgctattcttgtgttcttcgttattccttttgcaatgttctattatgaaggagaccaggac |
25050924 |
T |
 |
| Q |
219 |
aagtaggttgtttttgtttgtgtgaagattt |
249 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
25050925 |
aagtacgttgtttttgtttgtgtgaagattt |
25050955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 320 - 367
Target Start/End: Original strand, 25051027 - 25051074
Alignment:
| Q |
320 |
caggagtattggtaaaaggattaagagtgcattgatgtggatgatgtc |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25051027 |
caggagtattggtaaaaggattaagagtgcattgatgtggatggtgtc |
25051074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University