View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16399_high_14 (Length: 332)
Name: NF16399_high_14
Description: NF16399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16399_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 23 - 314
Target Start/End: Original strand, 35843801 - 35844092
Alignment:
| Q |
23 |
ttgccggacaatttcagagacctatagaaaaatgaaacattccaatgacaccagtggattttccagcgactcattagcacgagaccttttactgtccatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35843801 |
ttgccggacaatttcagagacctatagaaaaatgaaacattccaatgacaccagtggattttccagcgactcattagcacgagaccttttaccgtccatg |
35843900 |
T |
 |
| Q |
123 |
gccggcatctctgttttccggcgacctttctccggcagcgttgttctgtcccttgcaactggagctcgactcgtttttcttgcagattgactccgaccca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35843901 |
gccggcatctctgttttccggcgacctttctccggcagcgttgttctgtcccttgcaactggagctcgactcgtttttcttgcagattgactccgaccca |
35844000 |
T |
 |
| Q |
223 |
cgacgggtctagcaacgctggtgtcggtacacgtcgccggtgaccgggaccgtcggaaagaattctcgccggaatctctccggcgacgcatt |
314 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35844001 |
cgactggtctagcaacgctggtgtcggtacacgtcgccggtgaccgggaccgtcggaaagaattctcgccggaatctctccggcgacgcatt |
35844092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 48 - 88
Target Start/End: Complemental strand, 3274772 - 3274732
Alignment:
| Q |
48 |
agaaaaatgaaacattccaatgacaccagtggattttccag |
88 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
3274772 |
agaaagatgaagcattccaatgacacaagtggattttccag |
3274732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University