View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16399_high_2 (Length: 738)
Name: NF16399_high_2
Description: NF16399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16399_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 1e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 23 - 236
Target Start/End: Complemental strand, 1081409 - 1081196
Alignment:
| Q |
23 |
tcgaccaacaaccgaaggagtagtttgtatatagactccacccgtgttgacactaagttgaaccccctgctgagccnnnnnnncttgtttggaaatggat |
122 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
1081409 |
tcgaccaataaccgaaggagtagtttgtatatagactccacccatgttgacattaagttgaaccccctgctgagccaaaaaa-cttgtttggaaatgtat |
1081311 |
T |
 |
| Q |
123 |
ttca-ccactagcaaagatggcttagaggcccaatgctcgttatgggagtgtttcaaaatttccattgcacatactaatgcactagttcctcctgtttcg |
221 |
Q |
| |
|
||| ||||||||||||||||||||||||| |||||||| | ||| |||||||| |||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
1081310 |
ttccgccactagcaaagatggcttagaggctcaatgctcatcatgcgagtgtttaaaaatttccattgcacatgataatgcactagttcctccggtttcg |
1081211 |
T |
 |
| Q |
222 |
acggacatggcgcat |
236 |
Q |
| |
|
|| || ||||||||| |
|
|
| T |
1081210 |
acagatatggcgcat |
1081196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 60
Target Start/End: Original strand, 2835813 - 2835851
Alignment:
| Q |
21 |
ggtcgaccaacaaccgaaggagtagtttgtatatagactc |
60 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2835813 |
ggtcgaccaacaac-gaaggagtagtttgtatatagactc |
2835851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University