View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639_high_14 (Length: 336)
Name: NF1639_high_14
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 17 - 147
Target Start/End: Complemental strand, 12523887 - 12523757
Alignment:
| Q |
17 |
agttaaagcactacattaaaaatcacagaatatttatttatgactttgtgcatagtttagttctagaattgatccttcaacnnnnnnnnngtttctagaa |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12523887 |
agttaaggcactacattaaaaatcacagaatatttatttatgactttgtgcatagtttagttctagaattgatccttcaacaaaaaaaaagtttctagaa |
12523788 |
T |
 |
| Q |
117 |
tttatgtctacaaataagaatcaagaactaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12523787 |
tttatgtctacaaataagaatcaagaactaa |
12523757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 215 - 326
Target Start/End: Complemental strand, 12523689 - 12523579
Alignment:
| Q |
215 |
gaaattattatgatccgacaccagctccccaatgcacaccattctctgtaaatatgagatggaaagnnnnnnnntacaaaattacagtataaaaaattca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12523689 |
gaaattattatgatccgacaccagctccccaatgcacaccattctctgtaaatatgagatggaaag-aaaaaaatacaaaattacagtataaaaaattca |
12523591 |
T |
 |
| Q |
315 |
aggttttttctt |
326 |
Q |
| |
|
||||||||||| |
|
|
| T |
12523590 |
cggttttttctt |
12523579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University