View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639_high_17 (Length: 306)
Name: NF1639_high_17
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 39693895 - 39694189
Alignment:
| Q |
1 |
taaaaatctcacgttatttataagtgagagtataaactcaatgtcttaagattttgggttaagatatggtgtccaactcacttgtggttgctctgaccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39693895 |
taaaaatctcacgttatttataagtgagagcataaactcaatgccttaagattttgggttaagatgtggtgtccaactcacttgtggttgctctgaccta |
39693994 |
T |
 |
| Q |
101 |
gtgtgtatgatcctctgaactccactcatgactcaacaaaccctaacaaacaacattgcctaactgttttctaacaggggatgcatcttgtgatagtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39693995 |
gtgtgtatgatcctctgaactccactcatgactcaacaaaccctaacaaacaacattgcctaactgttttctaacaggggatgcatcttgtgatagtttt |
39694094 |
T |
 |
| Q |
201 |
ggtggtggagaaatcagtgatttattttattgaaagaaaatca----ttacagtaattgttgcttcttaaattgaggcgaaaacactgaatatga |
291 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39694095 |
ggtggtggagaaatcagtgatttattttactgaaagaaaatcattacttacagtaattgttgcttcttaaattgaggcgaaaacactgaatatga |
39694189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 32 - 96
Target Start/End: Original strand, 2336696 - 2336762
Alignment:
| Q |
32 |
ataaactcaatgtcttaagattttgggttaagatatggtgtccaactcact--tgtggttgctctga |
96 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
2336696 |
ataaattcaatgccttaagattttgggttaagatgtggtgtccaactcacttgtgtggttgctctga |
2336762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 39 - 85
Target Start/End: Original strand, 2323694 - 2323740
Alignment:
| Q |
39 |
caatgtcttaagattttgggttaagatatggtgtccaactcacttgt |
85 |
Q |
| |
|
||||| |||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
2323694 |
caatgccttaaggttttaggttaagatgtggtgtccaactcacttgt |
2323740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 32 - 86
Target Start/End: Original strand, 29802613 - 29802667
Alignment:
| Q |
32 |
ataaactcaatgtcttaagattttgggttaagatatggtgtccaactcacttgtg |
86 |
Q |
| |
|
|||||| ||||| |||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29802613 |
ataaacccaatgccttaaggttttgtgttaagatatggtgtccaactcacttgtg |
29802667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 138
Target Start/End: Original strand, 31957580 - 31957681
Alignment:
| Q |
40 |
aatgtcttaagattttgggttaagatatggtgtccaactcactt--gtggttgctc-tgacctagtgtgtatgatcctctgaactccactcatgactcaa |
136 |
Q |
| |
|
|||| |||||| |||||||||||||| ||||||||||||||||| |||||||||| || ||| || | ||||||| |||| |||| |||||||| ||| |
|
|
| T |
31957580 |
aatgccttaaggttttgggttaagatgtggtgtccaactcacttgcgtggttgctcttgccctgatgaggatgatcccctgagctcccctcatgacccaa |
31957679 |
T |
 |
| Q |
137 |
ca |
138 |
Q |
| |
|
|| |
|
|
| T |
31957680 |
ca |
31957681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 35 - 85
Target Start/End: Complemental strand, 23210876 - 23210827
Alignment:
| Q |
35 |
aactcaatgtcttaagattttgggttaagatatggtgtccaactcacttgt |
85 |
Q |
| |
|
|||||||||||||||||||| || ||||||| || |||||||||||||||| |
|
|
| T |
23210876 |
aactcaatgtcttaagatttagg-ttaagatgtgatgtccaactcacttgt |
23210827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 39 - 94
Target Start/End: Original strand, 30788297 - 30788354
Alignment:
| Q |
39 |
caatgtcttaagattttgggttaagatatggtgtccaactcactt--gtggttgctct |
94 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
30788297 |
caatgtcttaaggttttgggttaagatgtggtgttcaactcaattgagtggttgctct |
30788354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 86
Target Start/End: Original strand, 2041166 - 2041207
Alignment:
| Q |
45 |
cttaagattttgggttaagatatggtgtccaactcacttgtg |
86 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
2041166 |
cttaaggttttgggtgaagatgtggtgtccaactcacttgtg |
2041207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 65
Target Start/End: Original strand, 50400019 - 50400048
Alignment:
| Q |
36 |
actcaatgtcttaagattttgggttaagat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50400019 |
actcaatgtcttaagattttgggttaagat |
50400048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 39 - 86
Target Start/End: Complemental strand, 23714939 - 23714892
Alignment:
| Q |
39 |
caatgtcttaagattttgggttaagatatggtgtccaactcacttgtg |
86 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
23714939 |
caatgccttaagattttgggtgaagatgtggtgtccaactcacttgtg |
23714892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 7192787 - 7192838
Alignment:
| Q |
32 |
ataaactcaatgtcttaagattttgggttaagatatggtgtccaactcactt |
83 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||| || |||||||||||||| |
|
|
| T |
7192787 |
ataaactcaatgtcttaaggttttgagtaaagatgtgatgtccaactcactt |
7192838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 85
Target Start/End: Original strand, 7373363 - 7373408
Alignment:
| Q |
40 |
aatgtcttaagattttgggttaagatatggtgtccaactcacttgt |
85 |
Q |
| |
|
|||||||||| ||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
7373363 |
aatgtcttaaaatttttggttaagatgtggtgtccaactcacttgt |
7373408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 85
Target Start/End: Complemental strand, 8240429 - 8240396
Alignment:
| Q |
52 |
ttttgggttaagatatggtgtccaactcacttgt |
85 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
8240429 |
ttttgggttaagatgtggtgtccaactcacttgt |
8240396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 47493819 - 47493871
Alignment:
| Q |
31 |
tataaactcaatgtcttaagattttgggttaagatatggtgtccaactcactt |
83 |
Q |
| |
|
|||||||||||| |||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
47493819 |
tataaactcaatatcttaaaattttgagttaagatattacgtccaactcactt |
47493871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 78
Target Start/End: Original strand, 11970314 - 11970360
Alignment:
| Q |
32 |
ataaactcaatgtcttaagattttgggttaagatatggtgtccaact |
78 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
11970314 |
ataaactcaatgcctttagattttgggttaagatgtggtgcccaact |
11970360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 86
Target Start/End: Original strand, 40991825 - 40991879
Alignment:
| Q |
32 |
ataaactcaatgtcttaagattttgggttaagatatggtgtccaactcacttgtg |
86 |
Q |
| |
|
|||||| ||||| || ||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
40991825 |
ataaacccaatgcctcaaggttttgggttaagatgtggtgtccaactcacctgtg |
40991879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 86
Target Start/End: Original strand, 41857496 - 41857550
Alignment:
| Q |
32 |
ataaactcaatgtcttaagattttgggttaagatatggtgtccaactcacttgtg |
86 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| || ||| ||||||||||||| |
|
|
| T |
41857496 |
ataaactcaatgacttaaagttttgggttaagatgtgatgttcaactcacttgtg |
41857550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 68
Target Start/End: Complemental strand, 10498881 - 10498844
Alignment:
| Q |
31 |
tataaactcaatgtcttaagattttgggttaagatatg |
68 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10498881 |
tataaactcaatgtcttaaagttttgggttaagatatg |
10498844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 29028162 - 29028215
Alignment:
| Q |
32 |
ataaactcaatgtcttaagattttgggttaagatatggtgtccaactcacttgt |
85 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||| |||||||||||| |||||| |
|
|
| T |
29028162 |
ataaactcaatgtcctaatgttttgagttaagatgtggtgtccaacttacttgt |
29028215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University