View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639_high_19 (Length: 290)
Name: NF1639_high_19
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639_high_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 21 - 290
Target Start/End: Complemental strand, 54074877 - 54074608
Alignment:
| Q |
21 |
ggaagaagataaaggcgtgtttggagaaacgagaacgagaacctcccaacctggtaataaaactgaaaccgttgagaacgagtttctgaagttgatggat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54074877 |
ggaagaagataaaggcgtgtttggagaaacgagaacgagaatctcccaatctggtaataaaactgaaaccgttgagaacgagtttctgaagttgatggat |
54074778 |
T |
 |
| Q |
121 |
gaaacacgacgtgattggtgtgaaaactcgttgacgatgttgttgtttttgtttgcattggtatgaacgacaacgtgattttttgcgtttagcttccatg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54074777 |
gaaacacgacgtgattggtgtgaaaactcgttgacgatgttgttgtttttgtttgcattggtatgaacgacaacgtgattttttgcgtttagcttccatg |
54074678 |
T |
 |
| Q |
221 |
gacgatcgtctaggtcgtaatcagggctccaaccagaaacggcgtgacgagagagatgaagagaaaatgc |
290 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
54074677 |
gacgatcgtcaaggtcgtaatcaggtctccaaccagaaacggcatcacgagagagatgaagagaaaatgc |
54074608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University