View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639_high_22 (Length: 260)
Name: NF1639_high_22
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639_high_22 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 42 - 260
Target Start/End: Original strand, 39693579 - 39693797
Alignment:
| Q |
42 |
aggtgtactttggtttggttatgtcaagcttacaactgatgttgatttgtgattgatcaactttacaagaagtttacaatgacaccacatacatgaacac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39693579 |
aggtgtactttggtttggttatgtcaagcttacaactgatgttgatttgtgattgatcaactttacaagaagtttacaatgacaccacatacatgaacac |
39693678 |
T |
|
| Q |
142 |
ttgaaaatcatggttaattctctctaaatgcatggttgataaagttcatagaagattaatgagtggagaaattgcttttggtgttggagtccattgttgt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39693679 |
ttgaaaatcatggttaattctctctaaatgcatggttgataaagttcatagaagattaatgagtggagaaattgcttttggtgttggagtccattgttgt |
39693778 |
T |
|
| Q |
242 |
gatgattttatttttgttt |
260 |
Q |
| |
|
||||||||| ||| ||||| |
|
|
| T |
39693779 |
gatgattttctttctgttt |
39693797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 39693523 - 39693570
Alignment:
| Q |
8 |
attatactaataaaaaagcctagaacaaagcactaggtgtactttggt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39693523 |
attatactaataaaaaagcctagaacaaagcactaggtgtactttggt |
39693570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University