View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639_high_24 (Length: 247)
Name: NF1639_high_24
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 14542200 - 14542100
Alignment:
| Q |
1 |
ttataaatcaatgaaatgtagtcattgaaattgacaattttctattagattagcttctccattataatttttaaaatcaatttcaaaatgattaatatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14542200 |
ttataaatcaatgaaatgtagtcattgaaattgacaattttctattagattagcttctccattataatttttaaaatcaatttcaaaatgattaatatga |
14542101 |
T |
|
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
14542100 |
t |
14542100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 173 - 236
Target Start/End: Complemental strand, 14542026 - 14541963
Alignment:
| Q |
173 |
tgattcactctagttatttttcagtccttcaaattatatcttatttttcactcttgtatatatt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14542026 |
tgattcactctagttatttttcagtcctttaaattatatcttatttttcactcttgtatatatt |
14541963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University