View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639_high_29 (Length: 224)
Name: NF1639_high_29
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 36687260 - 36687037
Alignment:
| Q |
1 |
taactatgttctctagcttagcatcttaatcaacaacnnnnnnnn-tccataatttcatcttattatcaatctgtcattataaaattcgaatactggtaa |
99 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36687260 |
taactatgttctctagcttaacatcttaatcaacaacaaaaaaaaatccataatttcatcttattatcaatctgtcattataaaattcgaatactggtaa |
36687161 |
T |
 |
| Q |
100 |
acccaatcaaatctcaccatatagatatttggaaatatatgatcgtgtgatttgatattatgcttcact-nnnnnnncttatatcgtcgatgcacatcga |
198 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
36687160 |
acccaataacatctcaccatatagatatttggaaatatatgatcgtgtgatttgatattttgcttcactaaaaaaaacttatatcgtcgatgcacatcga |
36687061 |
T |
 |
| Q |
199 |
ttaaataacctaatcatttaattt |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36687060 |
ttaaataacctaatcatttaattt |
36687037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University