View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639_high_31 (Length: 214)
Name: NF1639_high_31
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 2793988 - 2794174
Alignment:
| Q |
11 |
gtgagaagaagattaacattgagaaactgcttaaccctatcactgatactgtgtttaatcaccttgtttcgattggaaaggttataactgattttctgga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2793988 |
gtgacaagaagattaacattgagaaactgcttaaccctatcactgatactgtgtttaatcaccttgtttcgattggaaagcttataactgattttctgga |
2794087 |
T |
 |
| Q |
111 |
gtttgaggatgttgagggtggttttgattcttttgacggtgttgcagtggaatttgaagagaatgaagatgatgatgagaaggatgt |
197 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794088 |
gtttgaggatgtggagggtggttttgattcttttgacggtgttgcagtggaatttgaagagaatgaagatgatgatgagaaggatgt |
2794174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University