View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639_low_35 (Length: 215)
Name: NF1639_low_35
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 34 - 198
Target Start/End: Original strand, 52879558 - 52879722
Alignment:
| Q |
34 |
ctctctcaatgtgccttatagaagatgttttgtttttaatgtatttgttatggcttttgatggtctctcagattcgacaaagataataagaagggggtat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52879558 |
ctctctcaatgtgccttatagaagatgttttgtttttaatgtatttgttatggcttttgatggtctctcagattcgacaaagataataagaagggggtat |
52879657 |
T |
 |
| Q |
134 |
ttgaaggatattttatttggctggtaattggctatggctttggtaagtgcttttgtagttgtaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52879658 |
ttgaaggatattttatttggctggtaattggctatggctttggtaagtgcttttgtagttgtaat |
52879722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 103 - 189
Target Start/End: Complemental strand, 253398 - 253312
Alignment:
| Q |
103 |
agattcgacaaagataataagaagggggtatttgaaggatattttatttggctggtaattggctatggctttggtaagtgcttttgt |
189 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| | ||||||||| ||||| |||||||||||||||| ||||||||| ||||||| |
|
|
| T |
253398 |
agatttgacaaagataataagaagggagtattaaatggatattttctttggttggtaattggctatggaattggtaagttcttttgt |
253312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University