View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1640-INSERTION-5 (Length: 226)
Name: NF1640-INSERTION-5
Description: NF1640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1640-INSERTION-5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 8 - 226
Target Start/End: Complemental strand, 6285857 - 6285639
Alignment:
| Q |
8 |
ttaagggacctaaattgtaatttagcaacnnnnnnnn-cattcttttcattttattagtaaaactttcacatcattgtttctttaaagtaggaattannn |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6285857 |
ttaagggaactaaattgtaatttagcaacaaaaacaaacattcttttcattctattagtaaaactttcacatcattgtttctttaaagtaggaattattt |
6285758 |
T |
 |
| Q |
107 |
nnnngtagcaactctttttataaaattatttgatatannnnnnnagataagttgcatcgtgatgtcttttaagggttagaaatgcccaaaactaaaatac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6285757 |
ttt-gtagcaactctttttataaaattatttgatatatttttttagataagttgcatcgtgatgtcttttaagggttagaaatgcccaaaactaaaatac |
6285659 |
T |
 |
| Q |
207 |
cgttgacaaatgtctttata |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6285658 |
cgttgacaaatgtctttata |
6285639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University