View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16400_high_6 (Length: 256)

Name: NF16400_high_6
Description: NF16400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16400_high_6
NF16400_high_6
[»] chr7 (1 HSPs)
chr7 (17-247)||(37953446-37953676)


Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 37953676 - 37953446
Alignment:
17 tcgccgtcatctcattattaatcttcaataagatgtgggttccccttcctctccctccatgcacataaggaactcgtgggaatttagggtttacgtggga 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||||    
37953676 tcgccgtcatctcattattaatcttcaataagatgtgggttccccttcctctacctccatgcacataaggaactcgttggaatttagggtttacatggga 37953577  T
117 aagtggaaagagtgttttctcatgaattttaggaagatagagtgtttagaaggctaattattgctgcataaataaggaaatttgattgaacttatgtttt 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37953576 aagtggaaagagtgttttctcatgaattttaggaagatagagtgtttagaaggctaattattgctgcataaataaggaaatttgattgaacttatgtttt 37953477  T
217 aattgttttaatgatgattgtgtgatgatgt 247  Q
    ||||||||||||||||||||||||| |||||    
37953476 aattgttttaatgatgattgtgtgaagatgt 37953446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University