View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16401_high_16 (Length: 239)
Name: NF16401_high_16
Description: NF16401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16401_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 49265569 - 49265395
Alignment:
| Q |
1 |
ctgaatatcttatgaccggacaactaactataaaatctgatgtgtatagctatggagtggtcatgctcgaacttatttcaggacgtagggctcttgataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49265569 |
ctgaatatcttatgaccggacaactaactattaaatctgatgtgtatagctatggagtggtcatgctcgaacttatttcaggacgcagggctcttgataa |
49265470 |
T |
|
| Q |
101 |
tacacgacctcaaggagagcgtagtcttgttgaatgggtaagttcctcacttaataaactctactactacactaga |
176 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||| |
|
|
| T |
49265469 |
tacacgaccgcaaggagagcgtagtcttgttgaatgggtaagttcctcgcttaattaa-taaactactacactaga |
49265395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University