View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16401_low_15 (Length: 332)
Name: NF16401_low_15
Description: NF16401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16401_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 19 - 332
Target Start/End: Complemental strand, 52972290 - 52971980
Alignment:
| Q |
19 |
ctttaatcttttgcactatgtatctcccattgttcattagaaaaacacatcgtaaagccatatccctatataacttggacttcctttcggtattttcatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972290 |
ctttaatcttttgcactatgtatctcccattgttcattagaaaaacacatcgtaaagccatatccctatataacttggacttcctttcggtattttcatc |
52972191 |
T |
 |
| Q |
119 |
taaaaggtccataattgtcatcaattgaactacaaaaggtgatttgttaggctccccatctaaattttgatcccttgttttatcattgttttcttcgttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52972190 |
taaaaggtccataattgtcatcaattgaactacaaaaggtgatttgttaggctctccatctaaattttgatcccttgttttatcgttgttttcttcgttt |
52972091 |
T |
 |
| Q |
219 |
tgaatatctgcagtggatgtggatgtacccttattattattattactatcatcaacataatggtgtcctatagtagcaagataatcatctgaacaatatt |
318 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972090 |
tgaatatctgcggtggatgtggatgtacccttattatt---attactatcatcaacataatggtgtcctatagtagcaagataatcatctgaacaatatt |
52971994 |
T |
 |
| Q |
319 |
ggtaaaacacttgc |
332 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52971993 |
ggtaaaacacttgc |
52971980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University