View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16401_low_16 (Length: 272)
Name: NF16401_low_16
Description: NF16401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16401_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 24 - 230
Target Start/End: Original strand, 7886057 - 7886263
Alignment:
| Q |
24 |
gcatgcaccaaccaaacacccttgaggtctacttttttgcgtgtttattaaatttcgacttcaacgttggaattgcattaattgtaattttgtctacacc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7886057 |
gcatgcaccaaccaaacacccttgaggtctacttttttgcgtgtttattaaatttcgacttcaacgttggaattgcattaattgtaattttgtttacacc |
7886156 |
T |
 |
| Q |
124 |
aaaatcatataatcttacctgttggaagtatttgccaagacgttacagcgcaaacttcctgctgaatctccaacatgggtaaggaacttttggatgtcaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7886157 |
aaaatcatataatcttacctgttggaagtatttgctaagacgttacagcgcaaacttcctgctgaatctccaacatgggtaaggaacttttggatgtcaa |
7886256 |
T |
 |
| Q |
224 |
tgttctt |
230 |
Q |
| |
|
||||||| |
|
|
| T |
7886257 |
tgttctt |
7886263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University