View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16402_high_20 (Length: 249)
Name: NF16402_high_20
Description: NF16402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16402_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 231
Target Start/End: Original strand, 50635720 - 50635937
Alignment:
| Q |
14 |
ttcttccattgccagatctttgaattttaattattatttttgcaaattcattagttttggcttctttaaaatcggtgtgtttggtgtctgaaatggcact |
113 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50635720 |
ttcttccattgccatagctttgaattttaattataatttttgcaaattcattagttttggcttctttaaaataggtgtgtttggtgtctgaaatggcact |
50635819 |
T |
 |
| Q |
114 |
acacatgtggttatattcctttttaaattattgccactgtttatgtggttatattttttcaaacgacacatacaaataggacatgtaaaccgtcaaattc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50635820 |
acacatgtggttatattcctttttaaattattgccactgtttatgtggttatattttttcaaacgacacatacaaataggacatgtaaaccgtcaaattc |
50635919 |
T |
 |
| Q |
214 |
aagctgcgtggttgaaat |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
50635920 |
aagctgcgtggttgaaat |
50635937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University