View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16402_high_3 (Length: 415)
Name: NF16402_high_3
Description: NF16402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16402_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 20 - 407
Target Start/End: Original strand, 44574998 - 44575385
Alignment:
| Q |
20 |
aatcaagcctagtatgatttaaatcttgaccacctaaccaaggtgttttccctttatgtgatgttgctttatgaacaatgttgacaattaaggaaccagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574998 |
aatcaagcctagtatgatttaaatcttgaccacctaaccaaggtgttttccctttatgtgatgttgctttatgaacaatgttgacaattaaggaaccagt |
44575097 |
T |
|
| Q |
120 |
gtagtttgcaatggacaggctcaaaaagaagatggcaccagaaacagtcctcatagactccggcacttgaagggtaaagaattccattatagcaacagca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575098 |
gtagtttgcaatggacaggctcaaaaagaagatggcaccagaaacagtcctcatagactccggcacttgaagggtaaagaattccattatagcaacagca |
44575197 |
T |
|
| Q |
220 |
gcaaaggcttcatttaaaccggacagcgcaaactgcggcaagagcaaaccaaagctcacaggcgaaataaacgaattgtgtttcaaagccgagtcacgac |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575198 |
gcaaaggcttcatttaaaccggacagcgcaaactgcggcaagagcaaaccaaagctcacaggcgaaataaacgaattgtgtttcaaagccgagtcacgac |
44575297 |
T |
|
| Q |
320 |
gctttttctcaataactgcagctaccaacatgcataggatagataataatatcccaattctgattctgcatcccatgctcattcttct |
407 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575298 |
gctttttctcaacaactgcagctaccaacatgcataggatagataataatatcccaattctgattctgcatcccatgctcattcttct |
44575385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University