View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16402_low_21 (Length: 250)
Name: NF16402_low_21
Description: NF16402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16402_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 47 - 236
Target Start/End: Complemental strand, 50635681 - 50635492
Alignment:
| Q |
47 |
cctacctgcgaaactcaaagtagaaagggttttttggtaggagcgaggacagtataaacaaccatagaccataggaccaagaacaggacctcttccagct |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50635681 |
cctacctgcgaaactcaaagtagaaagggttttttggtaggagcgaggacagtataaacaaccatagaccataggaccaagaacaggacctcttccagct |
50635582 |
T |
|
| Q |
147 |
tcgtcgattcccattatgcaagcctccgatgcccattccggagccatagcagcttcagatcccattttcactgaacaactaaccgcgctt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50635581 |
tcgtcgattcccattatgcaagcctccgatgcccattccggagccatagcagcttcagatcccattttcactgaacaactaaccgcgctt |
50635492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University