View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16402_low_7 (Length: 395)
Name: NF16402_low_7
Description: NF16402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16402_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 35 - 272
Target Start/End: Original strand, 42040509 - 42040745
Alignment:
| Q |
35 |
ataatgtttcatcggtc-atgtatcactactnnnnnnnggctagttttacaatgcaatagaaagcactcccccaacctttatatgaggtaaaatacacaa |
133 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
42040509 |
ataatgtttcatcggtctatgtatcactactaaaaaaaggctagtttttcaatgcaatagaaagtactcccccaacctttatatgtggtaaaatacacaa |
42040608 |
T |
 |
| Q |
134 |
ttaaacttatattggtcatgtacaagtaatgcaaaattatttatgtatgcatttaatcaaatcacacaacaaatgcaatttgctatgtttgattctaann |
233 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42040609 |
ttaaacttatattggtcatgtacaagcaatgcaaaattatttatgtatgtatttaatcaaatcacacaacaaatgcaatttgctatgtttgattctaa-- |
42040706 |
T |
 |
| Q |
234 |
nnnnnnngttttaaatgaatacatatgttaaaagtttta |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42040707 |
tttttttgttttaaatgaatacatatgttaaaagtttta |
42040745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 315 - 385
Target Start/End: Original strand, 42040798 - 42040868
Alignment:
| Q |
315 |
attgttacggaattttcccaatttattaattttcatcaaagaatctgtgaggtatataaggtgggttcttc |
385 |
Q |
| |
|
|||||||| ||||||||| | |||| |||||| ||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
42040798 |
attgttactgaattttcctagtttactaatttccatcaaagaatctgtgaggtacataaggtggattcttc |
42040868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University