View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16404_high_10 (Length: 246)
Name: NF16404_high_10
Description: NF16404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16404_high_10 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 246
Target Start/End: Complemental strand, 36162286 - 36162045
Alignment:
| Q |
5 |
gagacgatttttatttgctactgacaaacaagttatctgcaccgtttcttgctcctccattaattgaagcagatcctactgttttcttgcttcactttct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36162286 |
gagacgatttttatttgctactgacaaacaagttatctgcaccgtttcttgctcctccattaattgaagcagatcctactgttttcttgcttcactttct |
36162187 |
T |
|
| Q |
105 |
tcactttttctccacaagtatggcattttttcaagaacgtttcattcatgttttaaggtagcagcactagatatttagtcaaattttgcatcatataata |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36162186 |
tcactttttctccacaagtatgacattttttcaagaacgtttcagtcatgttttaaggtagctgcactagatatttagtcaaattttgcatcatataata |
36162087 |
T |
|
| Q |
205 |
tactttgatgcattaggaacaatgttttggtgtatttatttt |
246 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
36162086 |
tactttgatgaattacgaacaatgttttggagtatttatttt |
36162045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 93 - 144
Target Start/End: Complemental strand, 36153257 - 36153207
Alignment:
| Q |
93 |
gcttcactttcttcactttttctccacaagtatggcattttttcaagaacgt |
144 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| || |||||||||||||| |
|
|
| T |
36153257 |
gcttcaccttcttcaccttttctccacaagtatgaca-tttttcaagaacgt |
36153207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University