View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16405_high_3 (Length: 357)
Name: NF16405_high_3
Description: NF16405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16405_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 9e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 201 - 342
Target Start/End: Original strand, 3704979 - 3705124
Alignment:
| Q |
201 |
aaaattttgaagtcaaaggtgtggtgaaaaccttatctccaaacaaactatatttctgaatatatattctctcattgtagtagtaaatcatcacaaata- |
299 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
3704979 |
aaaattttgaagtcaaaggtgcggtgaaaaccttatctccaaacaaactatatttctgaatatatattcccacattgtagtagtaaatcatcacaaatta |
3705078 |
T |
|
| Q |
300 |
---cctattttgcatgagtttgttgtaaaccatctgccttctaaat |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3705079 |
atgcctattttgcatgagtttgttgtaaaccatctgccttcgaaat |
3705124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 87 - 143
Target Start/End: Complemental strand, 2016776 - 2016720
Alignment:
| Q |
87 |
taagtttggttaaattgcatttaccggtttaactttaaaaactcttgtatacgacac |
143 |
Q |
| |
|
||||| ||||| ||||||| || |||||||||||||||| |||||| ||||||||| |
|
|
| T |
2016776 |
taagtatggttgaattgcacctatcggtttaactttaaaagctcttgaatacgacac |
2016720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University