View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16406_low_2 (Length: 326)
Name: NF16406_low_2
Description: NF16406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16406_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 38 - 309
Target Start/End: Complemental strand, 40625217 - 40624935
Alignment:
| Q |
38 |
tgtgtgttgtgtttgagcttagcccaacaagtgacttt--agcgtgtgtg------cgcgcgccta-tgcgtgcaacaagcaagtata--gtctaaaagg |
126 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
40625217 |
tgtgtgttgtgtttgagcttggcccaacaagtgactttttagcgtgtgtgtgcgctcgcgcgccttgtgcgtgcaacaagcaagtatatagtctaaaagg |
40625118 |
T |
|
| Q |
127 |
aagttaatccctagtttcaagtgtgtgtgcgcattgcatgaaaacataaagcagaggcacaatcttacaagaaaatgagaattgcatgaaaaatgaattg |
226 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40625117 |
aagctaatccctagtttcaagtgtgtgtgcgcattgcatgaaaacataaagcagaggcacaatgttacaagaaagtgagaattgcatgaaaaatgaattg |
40625018 |
T |
|
| Q |
227 |
gtttcggtgactaaagtgtgttcgataaatgtcctgtgttttttgctaaaatatgagtatgttgtttctgccactaagttaat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40625017 |
gtttcggtgactaaagtgtgttcgataaatgtcctgtgttttttgctaaaatatgagtatgttgtttctgccactaagttaat |
40624935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University