View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16406_low_4 (Length: 248)
Name: NF16406_low_4
Description: NF16406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16406_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 231
Target Start/End: Original strand, 7905529 - 7905749
Alignment:
| Q |
11 |
aagaagattaaggctatcaccatattcaacaagtgccttgatgtaattcatgacatatcttgtaagatgatgaacacctccaccaggaaaacatttattt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905529 |
aagaagattaaggctatcaccatattcaacaagtgccttgatgtaattcatgacatatcttgtaagatgatgaacacctccaccaggaaaacatttattt |
7905628 |
T |
 |
| Q |
111 |
gatggatttgttgcaatagcatttctaaatgcaagaaatgtagattttatagtatcaccaaagcttcttagaagtttgtgaaattcttctctaacaaaag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
7905629 |
gatggatttgttgcaatagcatttctaaatgcaagaaatgtagattttatagtatcaccaaagcttcttagaagtttgtgaaattctcctctgacaaaag |
7905728 |
T |
 |
| Q |
211 |
aatcaacttcttctatgaaca |
231 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
7905729 |
aatcaacttcttcaatgaaca |
7905749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University