View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16406_low_7 (Length: 226)
Name: NF16406_low_7
Description: NF16406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16406_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 30 - 144
Target Start/End: Complemental strand, 169407 - 169293
Alignment:
| Q |
30 |
ggatggatccagatcaagacagaatgcgggttagagaacaaagaagaacagagtatatatatagttggccttactattaagaagcaacaacatacagtac |
129 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
169407 |
ggatggatccagaccaagacagaatgcgggttagagaacaaagaagaacagagtatatttatagttggccttactattaagaagcaacaacatacagtac |
169308 |
T |
 |
| Q |
130 |
aatctttcttcgttg |
144 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
169307 |
aatctttcttcgttg |
169293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University