View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16407_low_11 (Length: 304)
Name: NF16407_low_11
Description: NF16407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16407_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 19396355 - 19396631
Alignment:
| Q |
16 |
ttttttcaatgcctctttaagtgtggttacacatttttccttgtattctgagtggctgcacaacattgtcacaagcctcgagtatttatcaacacgctcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396355 |
ttttttcaatgcctctttaagtgtggttacacatttttccttgtattctgagtggctgcacaacattgtcacaagcctcgagtatttatcaacacgctcg |
19396454 |
T |
|
| Q |
116 |
ggttctggcggtgcgttttgaactggtttcttatcattattattatgatctggtcctgatcttttgacaatgacaaatgttacagctgctataacacatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396455 |
ggttctggcggtgcgttttgaactggtttcttatcattattattatgatctggtcctgatcttttgacaatgacaaatgttacagctgctataacacatg |
19396554 |
T |
|
| Q |
216 |
ctatgagaacaacagaagttacaccgatcaaaatctttttcttaaggtgttgtttcgcattggcttttcgcctttct |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396555 |
ctatgagaacaacagaagttacaccgatcaaaatctttttcttaaggtgttgtttcgcattggcttttcgcctttct |
19396631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University