View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16408_low_14 (Length: 222)
Name: NF16408_low_14
Description: NF16408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16408_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 32650820 - 32650986
Alignment:
| Q |
1 |
gaatgaaagatttttgttttgagaaataaagagttgattnnnnnnngctaaccactataaatatcttctgtctccttcttcgattatgtggatatggggt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32650820 |
gaatgaaagatttttggtttgagaaataaagagttgattaaaaaaagctaaccactgtaaatatcttctgtctccttcttcaattgtgtggatatggggt |
32650919 |
T |
|
| Q |
101 |
tggagttgtggagaggaaatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32650920 |
tggagttgtggagaggaaatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta |
32650986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 167
Target Start/End: Complemental strand, 33854148 - 33854099
Alignment:
| Q |
118 |
aatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta |
167 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33854148 |
aatcaaagtggacgaaggtgatagaaattggagaagaatgaatggcagta |
33854099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 58 - 118
Target Start/End: Complemental strand, 33854239 - 33854179
Alignment:
| Q |
58 |
taaatatcttctgtctccttcttcgattatgtggatatggggttggagttgtggagaggaa |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
33854239 |
taaatatcttttgtctccttcttcgattgtgtggatatgggtttggagttatggagaggaa |
33854179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University