View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16409_high_10 (Length: 270)
Name: NF16409_high_10
Description: NF16409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16409_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 42595054 - 42595294
Alignment:
| Q |
14 |
atatgcttaatgctttatacttattttagagtccaaatttgtagctacccaacatgattgaaataaacccatcaatattttgcaaatctgttggctatta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42595054 |
atatgcttaatgctttatacttattttagagttcaaatttgtagctacccaacatgattgaaataaacccatcaatattttgcaaatctgttggctatta |
42595153 |
T |
 |
| Q |
114 |
aagaatataatgcgccacattggggatccattgtgaatgataattaggaaacataaatctgctggcttttttatttcgatttttgtccaccaatatttga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42595154 |
aagaatataatgcgccacattggggatccattgtgaatgataattaggaaacataaatctgctggcttttttatttcgatttttgtccaccaatatttga |
42595253 |
T |
 |
| Q |
214 |
tctgtgcattcatgcatttaactcgatccacatgatatctg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42595254 |
tctgtgcattcatgcatttaactcgatccacatgatatctg |
42595294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University