View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16409_low_13 (Length: 254)
Name: NF16409_low_13
Description: NF16409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16409_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 174
Target Start/End: Complemental strand, 24795152 - 24794998
Alignment:
| Q |
20 |
ttccactaagactattcataaaccttgcaaaaactctttctgtttcaggacttgaaggtctattgaaaagatgctcataaaactctttatcaatgatatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24795152 |
ttccactaagactattcataaaccttgcaaaaactctttctgtttcaggacttgaaggtctattgaaaagatgctcataaaactctttatcaatgatatt |
24795053 |
T |
|
| Q |
120 |
cgaaaaatatgaacttggagctgatttaaaccgtgttaaccctgaattcatttgt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24795052 |
cgaaaaatatgaacttggagctgatttaaaccgtgttaaccctgaattcatttgt |
24794998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 37 - 165
Target Start/End: Complemental strand, 42021608 - 42021480
Alignment:
| Q |
37 |
ataaaccttgcaaaaactctttctgtttcaggacttgaaggtctattgaaaagatgctcataaaactctttatcaatgatattcgaaaaatatgaacttg |
136 |
Q |
| |
|
|||||||||| |||||||| |||||||| |||||||| ||| ||||||||| |||||| || || ||| | |||||||| || ||||||||||||| |
|
|
| T |
42021608 |
ataaaccttgaaaaaactcgctctgtttctggacttgatggtttattgaaaacatgctcgtagaattctctgtcaatgatgttgttgaaatatgaacttg |
42021509 |
T |
|
| Q |
137 |
gagctgatttaaaccgtgttaaccctgaa |
165 |
Q |
| |
|
| |||||||||||||||||||| |||||| |
|
|
| T |
42021508 |
gtgctgatttaaaccgtgttaaacctgaa |
42021480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University