View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16409_low_16 (Length: 241)
Name: NF16409_low_16
Description: NF16409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16409_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 20 - 140
Target Start/End: Complemental strand, 22683407 - 22683287
Alignment:
| Q |
20 |
gtgataagtggtatcataggaacatactcagctactgcaagaatatttggcgatggagactaaatgatagtcttattttctttgtaaaactcacttcttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22683407 |
gtgataagtggtatcataggaacatactcagctacttcaagaatatttggcgatggagattaaatgatagtgttattttctttgtaaaactcacttcttt |
22683308 |
T |
|
| Q |
120 |
tcttggcttgtgttggatatt |
140 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
22683307 |
tcttggcttgtgttggatatt |
22683287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 120
Target Start/End: Complemental strand, 22694979 - 22694879
Alignment:
| Q |
20 |
gtgataagtggtatcataggaacatactcagctactgcaagaatatttggcgatggagactaaatgatagtcttattttctttgtaaaactcacttcttt |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| | | |||||||| |||||| ||| |
|
|
| T |
22694979 |
gtgataagtggtatcttaggaacatactcagctactacaagaatatttggcgatggagactaaatgatagtattaatattattgtaaaagtcactttttt |
22694880 |
T |
|
| Q |
120 |
t |
120 |
Q |
| |
|
| |
|
|
| T |
22694879 |
t |
22694879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University