View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1640_high_17 (Length: 280)
Name: NF1640_high_17
Description: NF1640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1640_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 44690145 - 44690399
Alignment:
| Q |
18 |
agtaacatggtccaactgtgcttactatttgtttgcatgtgttcacgtttgtgggtttagatgcattattatctccaaatgcgcatggagtgtttttcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44690145 |
agtaacatggtccaactgtgcttactatttgtttgcatgtgttcacgtttgtgggtttagatgcattattatctccaaatgcgcgtggagtgtttttcat |
44690244 |
T |
 |
| Q |
118 |
tacattacatgattgcacattggcattatattgtctcatcttgaagcaatctgcaattattttatcttgcttttttatagtatgataatttatctaaatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44690245 |
tacattacatgattgcacattggcattatattgtctcatcttgaagcaatctgcaattattttatcttgcttttttatagtatgataatttatctaaatc |
44690344 |
T |
 |
| Q |
218 |
aacaaatggatggataaaattagcactacaatactttggttgtgtgtttcatctc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44690345 |
aacaaatggatggataaaattagcactacaatactttggttgtgtgtttcatctc |
44690399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 250
Target Start/End: Original strand, 44690431 - 44690460
Alignment:
| Q |
221 |
aaatggatggataaaattagcactacaata |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44690431 |
aaatggatggataaaattagcactacaata |
44690460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University