View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1640_high_19 (Length: 265)
Name: NF1640_high_19
Description: NF1640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1640_high_19 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 96 - 265
Target Start/End: Original strand, 32377924 - 32378090
Alignment:
| Q |
96 |
cgtttctttatgtggacacnnnnnnntcatgggaaaaaatgttggcgggttatttggtaaagaagtggtattgggatcaatgcaatttttctatggtttc |
195 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377924 |
cgtttctttatgtggacacaaaaaaatcatgggaaaaaatgttggcgggttatttggtaaagaagtggtattgggatcaatgcaatttttctatggtttc |
32378023 |
T |
 |
| Q |
196 |
aaatcttcaaaggaataactcaataaaaaatatatatatttaaaggaagttttgttaggtgtgagtccgt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32378024 |
aaatcttcaaaggaataactcaataaaaaa---aaatatttaaaggaagttttgttaggtgtgagtccgt |
32378090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University