View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1640_high_22 (Length: 242)
Name: NF1640_high_22
Description: NF1640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1640_high_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 53 - 225
Target Start/End: Original strand, 32378242 - 32378416
Alignment:
| Q |
53 |
ttttaataatccgcatcttgcatgg--ttcaacaaagagcatacaaatatttgacgttaacataaatttaaatttaccgctaagagcatacaaataatcc |
150 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32378242 |
ttttaataatccgcgtcttgcatggggttcaacaaagagcatacaaatatttgacgttaacataaatttaaatttaccgctaagagcatacaaataatcc |
32378341 |
T |
|
| Q |
151 |
acgtcttgcatgagattctccaatgaacatacaaattggagcttcactccaaacatgcgttagtatatatcttac |
225 |
Q |
| |
|
|| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32378342 |
acatcttgcatgggattctccaatgagcatacaaattggagcttcactccaaacatgcgttagtataaatcttac |
32378416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University