View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1640_low_12 (Length: 325)
Name: NF1640_low_12
Description: NF1640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1640_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 16 - 320
Target Start/End: Original strand, 45459105 - 45459409
Alignment:
| Q |
16 |
cacaaggcatatgtggggaggattagtcgtggttgtctcttggtttgtttgagtttctggaacaaattttatgtgtgatgatgtgacgaagtaatgattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459105 |
cacaaggcatatgtggggaggattagtcgtggttgtctcttggtttgtttgagtttcgggaacaaattttatgtgtgatgatgtgacgaagtaatgattt |
45459204 |
T |
|
| Q |
116 |
ttgtcgatttcaaacaccctcatctacatgtcaacaactgtttcatcaagaaatttgaccaggagatatttcatgttgttggtcatcattctcaacattc |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459205 |
ttgtcgatttcaaacaccctcatctacttgtcaacaactgtttcatcaagaaatttgaccaggagatatttcatgttgttggtcatcattctcaacattc |
45459304 |
T |
|
| Q |
216 |
acaacatgcaccagtggaaggtatgttgtgacacaggtttcaagattggggaagttctctgcatgatgctaaactaagtcgggagtgttcatcttctctg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45459305 |
acaacatgcaccagtggaaggtatgttgtgacacaggttccaagattggggaagttctctgcatgatgctaaactaagtcgggagtgttcatcttttctg |
45459404 |
T |
|
| Q |
316 |
ctcct |
320 |
Q |
| |
|
|||| |
|
|
| T |
45459405 |
atcct |
45459409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 225
Target Start/End: Original strand, 12499706 - 12499747
Alignment:
| Q |
184 |
tttcatgttgttggtcatcattctcaacattcacaacatgca |
225 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
12499706 |
tttcatgttgtgggtcatcattctcaacattcatgacatgca |
12499747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University