View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1640_low_15 (Length: 309)
Name: NF1640_low_15
Description: NF1640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1640_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 57 - 222
Target Start/End: Complemental strand, 407355 - 407190
Alignment:
| Q |
57 |
tgattcagaaagccctaatttataactagagtaactgtctagacaatgcaatttgtgacataattttagtctaccaattttatgtggactataactatgc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
407355 |
tgattcagaaagccctaatttataactagagtaactgtctagacaatgcaatttgtgacataattttagtctaccaaatttatgtggactataactatgc |
407256 |
T |
 |
| Q |
157 |
aacttgttacctatatttaatcaaagaaatcacggtcgaaaacatggttgaagtgggagtgcatcc |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
407255 |
aacttgttacctatatttaatcaaggaaatcacggtcgaaaacatggttgaagtgggagtgcatcc |
407190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 785666 - 785730
Alignment:
| Q |
160 |
ttgttacctatatttaatcaaagaaatcacggtcgaaaacatggttgaagtgggagtgcatccca |
224 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785666 |
ttgttacctatatttaatcaaggaaatcacggtcgaaaacatggttgaagtgggagtgcatccca |
785730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University