View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1640_low_20 (Length: 280)
Name: NF1640_low_20
Description: NF1640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1640_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 21549880 - 21550124
Alignment:
| Q |
18 |
atcttggagatcacctcagtgaaataggactaaactatggtttttccggtccaatgggaggtgttggagacttaaatttccatatcggaagctcgttagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21549880 |
atcttggagatcacctcagtgaaataggactaaactatggtttttctggtccaatgggaggtgttggagacttaaatttccatatcggaagctctttagg |
21549979 |
T |
|
| Q |
118 |
tggaggcgttggtaacggtggtggttcttcttcgattttacctgttggtagttttgagcaatggaggatgccacaaactcatcaatttcccttcttgtca |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21549980 |
tggaggcgttggtaacggtggtggttccgcttcgattttacctgttagtaattttgagcaatggaggatgccacaaactcatcaatttcccttcttgtca |
21550079 |
T |
|
| Q |
218 |
actttagaagcttcttcttcacatggattgttgtatccatttgaa |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21550080 |
actttagaagcttcttcttcacatggattgttgtatccatttgaa |
21550124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University