View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1640_low_6 (Length: 373)
Name: NF1640_low_6
Description: NF1640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1640_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 20 - 360
Target Start/End: Original strand, 15359224 - 15359564
Alignment:
| Q |
20 |
agttgcacaacacatgcagctagtaaagaagtaagatcgcgatttgcgcttttcttttcctttaggtgaagtatacgacacttccttcacttcaatcatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
15359224 |
agttgcacaacacatgcagctagtaaagaagtaagatcgcgatttgcgcttttcttttcctttaggtgaagtagacgacacttccttcacttcaatcttt |
15359323 |
T |
 |
| Q |
120 |
gaaccagcattgatatcttgtgtctgttccatgactagaacatgagcttcttcttcttttaagaaaccaatgaatgaagctttagatatctccgagtaac |
219 |
Q |
| |
|
|||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359324 |
gaaccaacatttatatcttgtgtctgtgccatgactagaacatgagcttcttcttcttttaagaaaccaatgaatgaagctttagatatctccgagtaac |
15359423 |
T |
 |
| Q |
220 |
ttctttccatagtaactattttctcttcaatgagaccatgctcatcatgagacattgagttgctgatatttagacttgccttgtttgacaagttatcatc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
15359424 |
ttctttccatagtaactattttctcttcaatgagaccatactcatcatgagacattgagttgctgatatttagacttgccttgtttggcaagctatcatc |
15359523 |
T |
 |
| Q |
320 |
tgaagacttatcaagcaatggaatttgatccgattcatctc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15359524 |
tgaagacttatcaagcaatggaatttgatccgattcttctc |
15359564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University